Medium.txt

1)**Integer to Roman**  
Given an integer, convert it to a roman numeral.
Input is guaranteed to be within the range from 1 to 3999.

2)**Path Sum II**  
Given a binary tree and a sum, find all root-to-leaf paths where each path's sum equals the given sum.

3)**Kth Largest Element in an Array**  
Find the kth largest element in an unsorted array. Note that it is the kth largest element in the sorted order, not the kth distinct element.  
For example,
Given [3,2,1,5,6,4] and k = 2, return 5.

4)**Missing Number**  
Given an array containing n distinct numbers taken from 0, 1, 2, ..., n, find the one that is missing from the array.  
For example,
Given nums = [0, 1, 3] return 2.  
Note:
Your algorithm should run in linear runtime complexity. Could you implement it using only constant extra space complexity?  

5)**Count Complete Tree Nodes**  
Given a complete binary tree, count the number of nodes.  
Definition of a complete binary tree from Wikipedia:  
In a complete binary tree every level, except possibly the last, is completely filled, and all nodes in the last level are as far left as possible. It can have between 1 and 2h nodes inclusive at the last level h.  

6)**Minimum Path Sum**  
Given a m x n grid filled with non-negative numbers, find a path from top left to bottom right which minimizes the sum of all numbers along its path.  
Note: You can only move either down or right at any point in time.  

7)**Find Peak Element**  
A peak element is an element that is greater than its neighbors.
Given an input array where num[i] ≠ num[i+1], find a peak element and return its index.
The array may contain multiple peaks, in that case return the index to any one of the peaks is fine.
You may imagine that num[-1] = num[n] = -∞.  
For example, in array [1, 2, 3, 1], 3 is a peak element and your function should return the index number 2.

8) **Sum Root to Leaf Numbers**  
Given a binary tree containing digits from 0-9 only, each root-to-leaf path could represent a number.
An example is the root-to-leaf path 1->2->3 which represents the number 123.
Find the total sum of all root-to-leaf numbers.  
For example,  
    1
   / \
  2   3
The root-to-leaf path 1->2 represents the number 12.  
The root-to-leaf path 1->3 represents the number 13.  
Return the sum = 12 + 13 = 25.

9) **Path Sum II**  
Given a binary tree and a sum, find all root-to-leaf paths where each path's sum equals the given sum.
For example:
Given the below binary tree and sum = 22,
              5
             / \
            4   8
           /   / \
          11  13  4
         /  \    / \
        7    2  5   1
return
[
   [5,4,11,2],
   [5,8,4,5]
]

10) **Minimum Size Subarray Sum**  
Given an array of n positive integers and a positive integer s, find the minimal length of a subarray of which the sum ≥ s. If there isn't one, return 0 instead.
For example, given the array [2,3,1,2,4,3] and s = 7,
the subarray [4,3] has the minimal length under the problem constraint.

11) **Find Minimum in Rotated Sorted Array**  
Suppose a sorted array is rotated at some pivot unknown to you beforehand.
(i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2).
Find the minimum element.
You may assume no duplicate exists in the array.

12)**3Sum**  
Given an array S of n integers, are there elements a, b, c in S such that a + b + c = 0? Find all unique triplets in the array which gives the sum of zero.
Note: The solution set must not contain duplicate triplets.
For example, given array S = [-1, 0, 1, 2, -1, -4],
A solution set is:
[
  [-1, 0, 1],
  [-1, -1, 2]
]

13)**H-Index**  
Given an array of citations (each citation is a non-negative integer) of a researcher, write a function to compute the researcher's h-index.
According to the definition of h-index on Wikipedia: "A scientist has index h if h of his/her N papers have at least h citations each, and the other N − h papers have no more than h citations each."
For example, given citations = [3, 0, 6, 1, 5], which means the researcher has 5 papers in total and each of them had received 3, 0, 6, 1, 5 citations respectively. Since the researcher has 3 papers with at least 3 citations each and the remaining two with no more than 3 citations each, his h-index is 3.
Note: If there are several possible values for h, the maximum one is taken as the h-index.

14)**Insertion Sort Linked List**  

15)**Remove Duplicates from Sorted List II**  
Given a sorted linked list, delete all nodes that have duplicate numbers, leaving only distinct numbers from the original list.
For example,
Given 1->2->3->3->4->4->5, return 1->2->5.
Given 1->1->1->2->3, return 2->3.

16)**Odd Even Linked List**  
Given a singly linked list, group all odd nodes together followed by the even nodes. Please note here we are talking about the node number and not the value in the nodes.
You should try to do it in place. The program should run in O(1) space complexity and O(nodes) time complexity.
Example:
Given 1->2->3->4->5->NULL,
return 1->3->5->2->4->NULL.
Note:
The relative order inside both the even and odd groups should remain as it was in the input.
The first node is considered odd, the second node even and so on ...

17)**Add Two Numbers**  
You are given two linked lists representing two non-negative numbers. The digits are stored in reverse order and each of their nodes contain a single digit. Add the two numbers and return it as a linked list.

18)**Add Two Numbers II**  
You are given two linked lists representing two non-negative numbers. The most significant digit comes first and each of their nodes contain a single digit. Add the two numbers and return it as a linked list.
You may assume the two numbers do not contain any leading zero, except the number 0 itself.
Follow up:
What if you cannot modify the input lists? In other words, reversing the lists is not allowed.
Example:
Input: (7 -> 2 -> 4 -> 3) + (5 -> 6 -> 4)
Output: 7 -> 8 -> 0 -> 7

19)**Rotate List**  
Given a list, rotate the list to the right by k places, where k is non-negative.
For example:
Given 1->2->3->4->5->NULL and k = 2,
return 4->5->1->2->3->NULL.

20)**Maximum Subarray**  
Find the contiguous subarray within an array (containing at least one number) which has the largest sum.
For example, given the array [-2,1,-3,4,-1,2,1,-5,4],
the contiguous subarray [4,-1,2,1] has the largest sum = 6.


21)**Valid Perfect Square**  
Given a positive integer num, write a function which returns True if num is a perfect square else False.
Note: Do not use any built-in library function such as sqrt.

22)**Product of Array Except Self**  
Given an array of n integers where n > 1, nums, return an array output such that output[i] is equal to the product of all the elements of nums except nums[i].
Solve it without division and in O(n).
For example, given [1,2,3,4], return [24,12,8,6].
Follow up:
Could you solve it with constant space complexity? (Note: The output array does not count as extra space for the purpose of space complexity analysis.)

23)**Linked List Random Node**  
Given a singly linked list, return a random node's value from the linked list. Each node must have the same probability of being chosen.
Follow up:
What if the linked list is extremely large and its length is unknown to you? Could you solve this efficiently without using extra space?
Example:
// Init a singly linked list [1,2,3].
ListNode head = new ListNode(1);
head.next = new ListNode(2);
head.next.next = new ListNode(3);
Solution solution = new Solution(head);
// getRandom() should return either 1, 2, or 3 randomly. Each element should have equal probability of returning.
solution.getRandom();

24)**Shuffle an Array**  
Shuffle a set of numbers without duplicates.
Example:
// Init an array with set 1, 2, and 3.
int[] nums = {1,2,3};
Solution solution = new Solution(nums);
// Shuffle the array [1,2,3] and return its result. Any permutation of [1,2,3] must equally likely to be returned.
solution.shuffle();
// Resets the array back to its original configuration [1,2,3].
solution.reset();
// Returns the random shuffling of array [1,2,3].
solution.shuffle();

25)**Serialize and Deserialize BST**  
Serialization is the process of converting a data structure or object into a sequence of bits so that it can be stored in a file or memory buffer, or transmitted across a network connection link to be reconstructed later in the same or another computer environment.
Design an algorithm to serialize and deserialize a binary search tree. There is no restriction on how your serialization/deserialization algorithm should work. You just need to ensure that a binary search tree can be serialized to a string and this string can be deserialized to the original tree structure.
The encoded string should be as compact as possible.
Note: Do not use class member/global/static variables to store states. Your serialize and deserialize algorithms should be stateless.

26)**Binary Tree Inorder Traversal**  
Given a binary tree, return the inorder traversal of its nodes' values.

For example:
Given binary tree [1,null,2,3],
   1
    \
     2
    /
   3
return [1,3,2].

Note: Recursive solution is trivial, could you do it iteratively?


27) **Binary Tree Preorder Traversal**
Given a binary tree, return the preorder traversal of its nodes' values.

For example:
Given binary tree {1,#,2,3},
   1
    \
     2
    /
   3
return [1,2,3].

Note: Recursive solution is trivial, could you do it iteratively?

28)**Flatten Binary Tree to Linked List**
Given a binary tree, flatten it to a linked list in-place.

For example,
Given

         1
        / \
       2   5
      / \   \
     3   4   6
The flattened tree should look like:
   1
    \
     2
      \
       3
        \
         4
          \
           5
            \
             6
29)**Binary Search Tree Iterator**
Implement an iterator over a binary search tree (BST). Your iterator will be initialized with the root node of a BST.
Calling next() will return the next smallest number in the BST.
Note: next() and hasNext() should run in average O(1) time and uses O(h) memory, where h is the height of the tree.

30)**Verify Preorder Serialization of a Binary Tree**
One way to serialize a binary tree is to use pre-order traversal. When we encounter a non-null node, we record the node's value. If it is a null node, we record using a sentinel value such as #.
     _9_
    /   \
   3     2
  / \   / \
 4   1  #  6
/ \ / \   / \
# # # #   # #
For example, the above binary tree can be serialized to the string "9,3,4,#,#,1,#,#,2,#,6,#,#", where # represents a null node.

Given a string of comma separated values, verify whether it is a correct preorder traversal serialization of a binary tree. Find an algorithm without reconstructing the tree.

Each comma separated value in the string must be either an integer or a character '#' representing null pointer.

You may assume that the input format is always valid, for example it could never contain two consecutive commas such as "1,,3".
Example 1:
"9,3,4,#,#,1,#,#,2,#,6,#,#"
Return true
Example 2:
"1,#"
Return false
Example 3:
"9,#,#,1"
Return false

31) **Top K Frequent Elements**
Given a non-empty array of integers, return the k most frequent elements.
For example,
Given [1,1,1,2,2,3] and k = 2, return [1,2].
Note: 
You may assume k is always valid, 1 ≤ k ≤ number of unique elements.
Your algorithm's time complexity must be better than O(n log n), where n is the array's size.

32) **Merge k Sorted Lists**

33) **Integer Break**
Given a positive integer n, break it into the sum of at least two positive integers and maximize the product of those integers. Return the maximum product you can get.
For example, given n = 2, return 1 (2 = 1 + 1); given n = 10, return 36 (10 = 3 + 3 + 4).
Note: You may assume that n is not less than 2 and not larger than 58.

34) Find All Duplicates in an Array
Given an array of integers, 1 ≤ a[i] ≤ n (n = size of array), some elements appear twice and others appear once.
Find all the elements that appear twice in this array.
Could you do it without extra space and in O(n) runtime?
Example:
Input:
[4,3,2,7,8,2,3,1]
Output:
[2,3]

35)**Convert Sorted List to Binary Search Tree**
Given a singly linked list where elements are sorted in ascending order, convert it to a height balanced BST.

36) **Validate Binary Search Tree**
Given a binary tree, determine if it is a valid binary search tree (BST).
Assume a BST is defined as follows:
The left subtree of a node contains only nodes with keys less than the node's key.
The right subtree of a node contains only nodes with keys greater than the node's key.
Both the left and right subtrees must also be binary search trees.

37)**Convert Sorted Array to Binary Search Tree**
38) **Clone Graph**
Clone an undirected graph. Each node in the graph contains a label and a list of its neighbors.

39)**PeekingIterator**
Given an Iterator class interface with methods: next() and hasNext(), design and implement a PeekingIterator that support the peek() operation -- it essentially peek() at the element that will be returned by the next call to next().
Here is an example. Assume that the iterator is initialized to the beginning of the list: [1, 2, 3].
Call next() gets you 1, the first element in the list.
Now you call peek() and it returns 2, the next element. Calling next() after that still return 2.
You call next() the final time and it returns 3, the last element. Calling hasNext() after that should return false.

40)**Reconstruct Original Digits from English**
Given a non-empty string containing an out-of-order English representation of digits 0-9, output the digits in ascending order.
Note:
Input contains only lowercase English letters.
Input is guaranteed to be valid and can be transformed to its original digits. That means invalid inputs such as "abc" or "zerone" are not permitted.
Input length is less than 50,000.
Example 1:
Input: "owoztneoer"
Output: "012"
Example 2:
Input: "fviefuro"
Output: "45"

41) **Binary Tree Zigzag Level Order Traversal**
Given a binary tree, return the zigzag level order traversal of its nodes' values. (ie, from left to right, then right to left for the next level and alternate between).
For example:
Given binary tree [3,9,20,null,null,15,7],
    3
   / \
  9  20
    /  \
   15   7
return its zigzag level order traversal as:
[
  [3],
  [20,9],
  [15,7]
]
42)**Magical String** 
A magical string S consists of only '1' and '2' and obeys the following rules:
The string S is magical because concatenating the number of contiguous occurrences of characters '1' and '2' generates the string S itself.
The first few elements of string S is the following: S = "1221121221221121122……"
If we group the consecutive '1's and '2's in S, it will be:
1 22 11 2 1 22 1 22 11 2 11 22 ......
and the occurrences of '1's or '2's in each group are:
1 2	2 1 1 2 1 2 2 1 2 2 ......
You can see that the occurrence sequence above is the S itself.
Given an integer N as input, return the number of '1's in the first N number in the magical string S.
Note: N will not exceed 100,000.

43)**License Key Formatting**
Now you are given a string S, which represents a software license key which we would like to format. The string S is composed of alphanumerical characters and dashes. The dashes split the alphanumerical characters within the string into groups. (i.e. if there are M dashes, the string is split into M+1 groups). The dashes in the given string are possibly misplaced.
We want each group of characters to be of length K (except for possibly the first group, which could be shorter, but still must contain at least one character). To satisfy this requirement, we will reinsert dashes. Additionally, all the lower case letters in the string must be converted to upper case.
So, you are given a non-empty string S, representing a license key to format, and an integer K. And you need to return the license key formatted according to the description above.
Example 1:
Input: S = "2-4A0r7-4k", K = 4
Output: "24A0-R74K"
Explanation: The string S has been split into two parts, each part has 4 characters.

44)**Reverse Linked List II**
Reverse a linked list from position m to n. Do it in-place and in one-pass.
For example:
Given 1->2->3->4->5->NULL, m = 2 and n = 4,
return 1->4->3->2->5->NULL.
Note:
Given m, n satisfy the following condition:
1 ≤ m ≤ n ≤ length of list.

45)**Sort List** 
Sort a linked list in O(n log n) time using constant space complexity.

46)**Reverse Words in a String**
Given an input string, reverse the string word by word.
For example,
Given s = "the sky is blue",
return "blue is sky the".

47) **Is Subsequence**
Given a string s and a string t, check if s is subsequence of t.
You may assume that there is only lower case English letters in both s and t. t is potentially a very long (length ~= 500,000) string, and s is a short string (<=100).
A subsequence of a string is a new string which is formed from the original string by deleting some (can be none) of the characters without disturbing the relative positions of the remaining characters. (ie, "ace" is a subsequence of "abcde" while "aec" is not).

48)**Binary Tree Right Side View**
Given a binary tree, imagine yourself standing on the right side of it, return the values of the nodes you can see ordered from top to bottom.
For example:
Given the following binary tree,
   1            <---
 /   \
2     3         <---
 \     \
  5     4       <---
You should return [1, 3, 4].

49) **Populating Next Right Pointers in Each Node**
Given a binary tree
    class TreeLinkNode {
      TreeLinkNode left;
      TreeLinkNode right;
      TreeLinkNode next;
      int val;
    }
Populate each next pointer to point to its next right node. If there is no next right node, the next pointer should be set to NULL.
Initially, all next pointers are set to NULL.
Note:
You may only use constant extra space.
You may assume that it is a perfect binary tree (ie, all leaves are at the same level, and every parent has two children).
For example,
Given the following perfect binary tree,
         1
       /  \
      2    3
     / \  / \
    4  5  6  7
After calling your function, the tree should look like:
         1 -> NULL
       /  \
      2 -> 3 -> NULL
     / \  / \
    4->5->6->7 -> NULL

50)**Remove K Digits**
Given a non-negative integer num represented as a string, remove k digits from the number so that the new number is the smallest possible.
Note:
The length of num is less than 10002 and will be ≥ k.
The given num does not contain any leading zero.
Example 1:
Input: num = "1432219", k = 3
Output: "1219"
Explanation: Remove the three digits 4, 3, and 2 to form the new number 1219 which is the smallest.
Example 2:


51)**Pow(x, n)**
Implement pow(x, n).

52)**Battleships in a Board**
Given an 2D board, count how many different battleships are in it. The battleships are represented with 'X's, empty slots are represented with '.'s. You may assume the following rules:
You receive a valid board, made of only battleships or empty slots.
Battleships can only be placed horizontally or vertically. In other words, they can only be made of the shape 1xN (1 row, N columns) or Nx1 (N rows, 1 column), where N can be of any size.
At least one horizontal or vertical cell separates between two battleships - there are no adjacent battleships.
Example:
X..X
...X
...X
In the above board there are 2 battleships.
Invalid Example:
...X
XXXX
...X
This is an invalid board that you will not receive - as battleships will always have a cell separating between them.

53)**Letter Combinations of a Phone Number**
Given a digit string, return all possible letter combinations that the number could represent.
A mapping of digit to letters (just like on the telephone buttons) is given below.
Input:Digit string "23"
Output: ["ad", "ae", "af", "bd", "be", "bf", "cd", "ce", "cf"].

54) **Word Search**
Given a 2D board and a word, find if the word exists in the grid.
The word can be constructed from letters of sequentially adjacent cell, where "adjacent" cells are those horizontally or vertically neighboring. The same letter cell may not be used more than once.
For example,
Given board =
[
  ['A','B','C','E'],
  ['S','F','C','S'],
  ['A','D','E','E']
]
word = "ABCCED", -> returns true,
word = "SEE", -> returns true,
word = "ABCB", -> returns false.

55)**Delete Node in a BST**
Given a root node reference of a BST and a key, delete the node with the given key in the BST. Return the root node reference (possibly updated) of the BST.
Basically, the deletion can be divided into two stages:
Search for a node to remove.
If the node is found, delete the node.
Note: Time complexity should be O(height of tree).

56) **Permutations**
Given a collection of distinct numbers, return all possible permutations.
For example,
[1,2,3] have the following permutations:
[
  [1,2,3],
  [1,3,2],
  [2,1,3],
  [2,3,1],
  [3,1,2],
  [3,2,1]
]
57)4Sum II
Given four lists A, B, C, D of integer values, compute how many tuples (i, j, k, l) there are such that A[i] + B[j] + C[k] + D[l] is zero.
To make problem a bit easier, all A, B, C, D have same length of N where 0 ≤ N ≤ 500. All integers are in the range of -228 to 228 - 1 and the result is guaranteed to be at most 231 - 1.
Example:
Input:
A = [ 1, 2]
B = [-2,-1]
C = [-1, 2]
D = [ 0, 2]
Output:
2
Explanation:
The two tuples are:
1. (0, 0, 0, 1) -> A[0] + B[0] + C[0] + D[1] = 1 + (-2) + (-1) + 2 = 0
2. (1, 1, 0, 0) -> A[1] + B[1] + C[0] + D[0] = 2 + (-1) + (-1) + 0 = 0

58)**Gas Station**
There are N gas stations along a circular route, where the amount of gas at station i is gas[i].
You have a car with an unlimited gas tank and it costs cost[i] of gas to travel from station i to its next station (i+1). You begin the journey with an empty tank at one of the gas stations.
Return the starting gas station's index if you can travel around the circuit once, otherwise return -1.

59)**Integer Replacement**
Given a positive integer n and you can do operations as follow:

If n is even, replace n with n/2.
If n is odd, you can replace n with either n + 1 or n - 1.
What is the minimum number of replacements needed for n to become 1?
Example 1:
Input:
8
Output:
3
Explanation:
8 -> 4 -> 2 -> 1

60)Linked List Cycle II
Given a linked list, return the node where the cycle begins. If there is no cycle, return null.
Note: Do not modify the linked list.

61)**Max Consecutive Ones II**
Given a binary array, find the maximum number of consecutive 1s in this array if you can flip at most one 0.
Example 1:
Input: [1,0,1,1,0]
Output: 4
Explanation: Flip the first zero will get the maximum number of consecutive 1s.
After flipping, the maximum number of consecutive 1s is 4.
Note:
The input array will only contain 0 and 1.
The length of input array is a positive integer and will not exceed 10,000


62)**Longest Increasing Subsequence**
Given an unsorted array of integers, find the length of longest increasing subsequence.
For example,
Given [10, 9, 2, 5, 3, 7, 101, 18],
The longest increasing subsequence is [2, 3, 7, 101], therefore the length is 4. Note that there may be more than one LIS combination, it is only necessary for you to return the length.
Your algorithm should run in O(n2) complexity.
Follow up: Could you improve it to O(n log n) time complexity?

63)Partition List
Given a linked list and a value x, partition it such that all nodes less than x come before nodes greater than or equal to x.
You should preserve the original relative order of the nodes in each of the two partitions.
For example,
Given 1->4->3->2->5->2 and x = 3,
return 1->2->2->4->3->5.

64) Random Pick Index
Given an array of integers with possible duplicates, randomly output the index of a given target number. You can assume that the given target number must exist in the array.
Note:
The array size can be very large. Solution that uses too much extra space will not pass the judge.
Example:
int[] nums = new int[] {1,2,3,3,3};
Solution solution = new Solution(nums);
// pick(3) should return either index 2, 3, or 4 randomly. Each index should have equal probability of returning.
solution.pick(3);
// pick(1) should return 0. Since in the array only nums[0] is equal to 1.
solution.pick(1);

65)Repeated DNA Sequences
All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.
For example,
Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",
Return:
["AAAAACCCCC", "CCCCCAAAAA"].

66)Sort Colors
Given an array with n objects colored red, white or blue, sort them so that objects of the same color are adjacent, with the colors in the order red, white and blue.
Here, we will use the integers 0, 1, and 2 to represent the color red, white, and blue respectively.
Note:
You are not suppose to use the library's sort function for this problem.

67)Reorder List
Given a singly linked list L: L0→L1→…→Ln-1→Ln,
reorder it to: L0→Ln→L1→Ln-1→L2→Ln-2→…
You must do this in-place without altering the nodes' values.
For example,
Given {1,2,3,4}, reorder it to {1,4,2,3}.

68)Path Sum III
You are given a binary tree in which each node contains an integer value.
Find the number of paths that sum to a given value.
The path does not need to start or end at the root or a leaf, but it must go downwards (traveling only from parent nodes to child nodes).
The tree has no more than 1,000 nodes and the values are in the range -1,000,000 to 1,000,000.
Example:
root = [10,5,-3,3,2,null,11,3,-2,null,1], sum = 8

      10
     /  \
    5   -3
   / \    \
  3   2   11
 / \   \
3  -2   1

Return 3. The paths that sum to 8 are:
1.  5 -> 3
2.  5 -> 2 -> 1
3. -3 -> 11

69)Unique Paths
A robot is located at the top-left corner of a m x n grid (marked 'Start' in the diagram below).
The robot can only move either down or right at any point in time. The robot is trying to reach the bottom-right corner of the grid (marked 'Finish' in the diagram below).
How many possible unique paths are there?

70)Unique Paths II
Follow up for "Unique Paths":
Now consider if some obstacles are added to the grids. How many unique paths would there be?
An obstacle and empty space is marked as 1 and 0 respectively in the grid.
For example,
There is one obstacle in the middle of a 3x3 grid as illustrated below.
[
  [0,0,0],
  [0,1,0],
  [0,0,0]
]
The total number of unique paths is 2.

71)Number of Islands
Given a 2d grid map of '1's (land) and '0's (water), count the number of islands. An island is surrounded by water and is formed by connecting adjacent lands horizontally or vertically. You may assume all four edges of the grid are all surrounded by water.

Example 1:

11110
11010
11000
00000
Answer: 1

Example 2:

11000
11000
00100
00011
Answer: 3

72) Increasing Subsequences
Given an integer array, your task is to find all the different possible increasing subsequences of the given array, and the length of an increasing subsequence should be at least 2 .
Example:
Input: [4, 6, 7, 7]
Output: [[4, 6], [4, 7], [4, 6, 7], [4, 6, 7, 7], [6, 7], [6, 7, 7], [7,7], [4,7,7]]
Note:
The length of the given array will not exceed 15.
The range of integer in the given array is [-100,100].
The given array may contain duplicates, and two equal integers should also be considered as a special case of increasing sequence.

73)Target Sum
You are given a list of non-negative integers, a1, a2, ..., an, and a target, S. Now you have 2 symbols + and -. For each integer, you should choose one from + and - as its new symbol.
Find out how many ways to assign symbols to make sum of integers equal to target S.
Example 1:
Input: nums is [1, 1, 1, 1, 1], S is 3.
Output: 5
Explanation:
-1+1+1+1+1 = 3
+1-1+1+1+1 = 3
+1+1-1+1+1 = 3
+1+1+1-1+1 = 3
+1+1+1+1-1 = 3
There are 5 ways to assign symbols to make the sum of nums be target 3.
Note:
The length of the given array is positive and will not exceed 20.
The sum of elements in the given array will not exceed 1000.
Your output answer is guaranteed to be fitted in a 32-bit integer.

74)Binary Tree Left Side View

75)Summary Ranges
Given a sorted integer array without duplicates, return the summary of its ranges.
For example, given [0,1,2,4,5,7], return ["0->2","4->5","7"].

76)Subsets II
Given a collection of integers that might contain duplicates, nums, return all possible subsets.
Note: The solution set must not contain duplicate subsets.
For example,
If nums = [1,2,2], a solution is:
[
  [2],
  [1],
  [1,2,2],
  [2,2],
  [1,2],
  []
]

77)Minimum Height Trees
For a undirected graph with tree characteristics, we can choose any node as the root. The result graph is then a rooted tree. Among all possible rooted trees, those with minimum height are called minimum height trees (MHTs). Given such a graph, write a function to find all the MHTs and return a list of their root labels.
Format
The graph contains n nodes which are labeled from 0 to n - 1. You will be given the number n and a list of undirected edges (each edge is a pair of labels).
You can assume that no duplicate edges will appear in edges. Since all edges are undirected, [0, 1] is the same as [1, 0] and thus will not appear together in edges.
Example 1:
Given n = 4, edges = [[1, 0], [1, 2], [1, 3]]
        0
        |
        1
       / \
      2   3
return [1]


78)Course Schedule
There are a total of n courses you have to take, labeled from 0 to n - 1.
Some courses may have prerequisites, for example to take course 0 you have to first take course 1, which is expressed as a pair: [0,1]
Given the total number of courses and a list of prerequisite pairs, is it possible for you to finish all courses?
For example:
2, [[1,0]]
There are a total of 2 courses to take. To take course 1 you should have finished course 0. So it is possible.
2, [[1,0],[0,1]]
There are a total of 2 courses to take. To take course 1 you should have finished course 0, and to take course 0 you should also have finished course 1. So it is impossible.
Note:
The input prerequisites is a graph represented by a list of edges, not adjacency matrices. Read more about how a graph is represented.

79)Course Schedule II
There are a total of n courses you have to take, labeled from 0 to n - 1.
Some courses may have prerequisites, for example to take course 0 you have to first take course 1, which is expressed as a pair: [0,1]
Given the total number of courses and a list of prerequisite pairs, return the ordering of courses you should take to finish all courses.
There may be multiple correct orders, you just need to return one of them. If it is impossible to finish all courses, return an empty array.
For example:
2, [[1,0]]
There are a total of 2 courses to take. To take course 1 you should have finished course 0. So the correct course order is [0,1]
4, [[1,0],[2,0],[3,1],[3,2]]
There are a total of 4 courses to take. To take course 3 you should have finished both courses 1 and 2. Both courses 1 and 2 should be taken after you finished course 0. So one correct course order is [0,1,2,3]. Another correct ordering is[0,2,1,3].
Note:
The input prerequisites is a graph represented by a list of edges, not adjacency matrices. Read more about how a graph is represented.

80)Set Matrix Zeroes
Given a m x n matrix, if an element is 0, set its entire row and column to 0. Do it in place.
    Follow up:
    Did you use extra space?
    A straight forward solution using O(mn) space is probably a bad idea.
    A simple improvement uses O(m + n) space, but still not the best solution.
    Could you devise a constant space solution?

81)Game of Life
According to the Wikipedia's article: "The Game of Life, also known simply as Life, is a cellular automaton devised by the British mathematician John Horton Conway in 1970."

Given a board with m by n cells, each cell has an initial state live (1) or dead (0). Each cell interacts with its eight neighbors (horizontal, vertical, diagonal) using the following four rules (taken from the above Wikipedia article):

Any live cell with fewer than two live neighbors dies, as if caused by under-population.
Any live cell with two or three live neighbors lives on to the next generation.
Any live cell with more than three live neighbors dies, as if by over-population..
Any dead cell with exactly three live neighbors becomes a live cell, as if by reproduction.
Write a function to compute the next state (after one update) of the board given its current state.

Follow up:
Could you solve it in-place? Remember that the board needs to be updated at the same time: You cannot update some cells first and then use their updated values to update other cells.
In this question, we represent the board using a 2D array. In principle, the board is infinite, which would cause problems when the active area encroaches the border of the array. How would you address these problems?

82)Merge Intervals
Given a collection of intervals, merge all overlapping intervals.
For example,
Given [1,3],[2,6],[8,10],[15,18],
return [1,6],[8,10],[15,18].

83)Find Mode in Binary Search Tree
Given a binary search tree (BST) with duplicates, find all the mode(s) (the most frequently occurred element) in the given BST.
Assume a BST is defined as follows:
The left subtree of a node contains only nodes with keys less than or equal to the node's key.
The right subtree of a node contains only nodes with keys greater than or equal to the node's key.
Both the left and right subtrees must also be binary search trees.


84)Teemo Attacking
In LLP world, there is a hero called Teemo and his attacking can make his enemy Ashe be in poisoned condition. Now, given the Teemo's attacking ascending time series towards Ashe and the poisoning time duration per Teemo's attacking, you need to output the total time that Ashe is in poisoned condition.
You may assume that Teemo attacks at the very beginning of a specific time point, and makes Ashe be in poisoned condition immediately.
Example 1:
Input: [1,4], 2
Output: 4
Explanation: At time point 1, Teemo starts attacking Ashe and makes Ashe be poisoned immediately.
This poisoned status will last 2 seconds until the end of time point 2.
And at time point 4, Teemo attacks Ashe again, and causes Ashe to be in poisoned status for another 2 seconds.
So you finally need to output 4.


85)Decode String
Given an encoded string, return it's decoded string.
The encoding rule is: k[encoded_string], where the encoded_string inside the square brackets is being repeated exactly k times. Note that k is guaranteed to be a positive integer.
You may assume that the input string is always valid; No extra white spaces, square brackets are well-formed, etc.
Furthermore, you may assume that the original data does not contain any digits and that digits are only for those repeat numbers, k. For example, there won't be input like 3a or 2[4].
Examples:
s = "3[a]2[bc]", return "aaabcbc".
s = "3[a2[c]]", return "accaccacc".
s = "2[abc]3[cd]ef", return "abcabccdcdcdef".

86)Find Right Interval
Given a set of intervals, for each of the interval i, check if there exists an interval j whose start point is bigger than or equal to the end point of the interval i, which can be called that j is on the "right" of i.
For any interval i, you need to store the minimum interval j's index, which means that the interval j has the minimum start point to build the "right" relationship for interval i. If the interval j doesn't exist, store -1 for the interval i. Finally, you need output the stored value of each interval as an array.
Note:
You may assume the interval's end point is always bigger than its start point.
You may assume none of these intervals have the same start point.
Example 1:
Input: [ [1,2] ]
Output: [-1]
Explanation: There is only one interval in the collection, so it outputs -1.
Example 2:
Input: [ [3,4], [2,3], [1,2] ]
Output: [-1, 0, 1]
Explanation: There is no satisfied "right" interval for [3,4].
For [2,3], the interval [3,4] has minimum-"right" start point;
For [1,2], the interval [2,3] has minimum-"right" start point.

87)Flatten Nested List Iterator
Given a nested list of integers, implement an iterator to flatten it.
Each element is either an integer, or a list -- whose elements may also be integers or other lists.
Example 1:
Given the list [[1,1],2,[1,1]],
By calling next repeatedly until hasNext returns false, the order of elements returned by next should be: [1,1,2,1,1].
Example 2:
Given the list [1,[4,[6]]],
By calling next repeatedly until hasNext returns false, the order of elements returned by next should be: [1,4,6].

88)Mini Parser
Given a nested list of integers represented as a string, implement a parser to deserialize it.
Each element is either an integer, or a list -- whose elements may also be integers or other lists.
Note: You may assume that the string is well-formed:
String is non-empty.
String does not contain white spaces.
String contains only digits 0-9, [, - ,, ].
Example 1:
Given s = "324",
You should return a NestedInteger object which contains a single integer 324.
Example 2:
Given s = "[123,[456,[789]]]",
Return a NestedInteger object containing a nested list with 2 elements:
1. An integer containing value 123.
2. A nested list containing two elements:
    i.  An integer containing value 456.
    ii. A nested list with one element:
         a. An integer containing value 789.

89)Add and Search Word - Data structure design
Design a data structure that supports the following two operations:

void addWord(word)
bool search(word)
search(word) can search a literal word or a regular expression string containing only letters a-z or .. A . means it can represent any one letter.
For example:
addWord("bad")
addWord("dad")
addWord("mad")
search("pad") -> false
search("bad") -> true
search(".ad") -> true
search("b..") -> true
Note:
You may assume that all words are consist of lowercase letters a-z.

90) Implement Trie (Prefix Tree)
Implement a trie with insert, search, and startsWith methods.
Note:
You may assume that all inputs are consist of lowercase letters a-z.

91)Rotate Image
You are given an n x n 2D matrix representing an image.

Rotate the image by 90 degrees (clockwise).

Follow up:
Could you do this in-place?

92)Search a 2D Matrix
Write an efficient algorithm that searches for a value in an m x n matrix. This matrix has the following properties:

Integers in each row are sorted from left to right.
The first integer of each row is greater than the last integer of the previous row.
For example,

Consider the following matrix:

[
  [1,   3,  5,  7],
  [10, 11, 16, 20],
  [23, 30, 34, 50]
]

93)Search a 2D Matrix II
Write an efficient algorithm that searches for a value in an m x n matrix. This matrix has the following properties:

Integers in each row are sorted in ascending from left to right.
Integers in each column are sorted in ascending from top to bottom.
For example,

Consider the following matrix:

[
  [1,   4,  7, 11, 15],
  [2,   5,  8, 12, 19],
  [3,   6,  9, 16, 22],
  [10, 13, 14, 17, 24],
  [18, 21, 23, 26, 30]
]
94)Evaluate Reverse Polish Notation
Evaluate the value of an arithmetic expression in Reverse Polish Notation.
Valid operators are +, -, *, /. Each operand may be an integer or another expression.
Some examples:
  ["2", "1", "+", "3", "*"] -> ((2 + 1) * 3) -> 9
  ["4", "13", "5", "/", "+"] -> (4 + (13 / 5)) -> 6

95)Valid Sudoku
Determine if a Sudoku is valid, according to: Sudoku Puzzles - The Rules.
A valid Sudoku board (partially filled) is not necessarily solvable. Only the filled cells need to be validated.

96)Spiral Matrix
Given a matrix of m x n elements (m rows, n columns), return all elements of the matrix in spiral order.
For example,
Given the following matrix:
[
 [ 1, 2, 3 ],
 [ 4, 5, 6 ],
 [ 7, 8, 9 ]
]
You should return [1,2,3,6,9,8,7,4,5].

97)Spiral Matrix II
Given an integer n, generate a square matrix filled with elements from 1 to n2 in spiral order.

For example,
Given n = 3,

You should return the following matrix:
[
 [ 1, 2, 3 ],
 [ 8, 9, 4 ],
 [ 7, 6, 5 ]
]
98) Search in Rotated Sorted Array
Suppose an array sorted in ascending order is rotated at some pivot unknown to you beforehand.
(i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2).
You are given a target value to search. If found in the array return its index, otherwise return -1.
You may assume no duplicate exists in the array.

99) Search in Rotated Sorted Array II
Follow up for "Search in Rotated Sorted Array":
What if duplicates are allowed?
Would this affect the run-time complexity? How and why?
Suppose an array sorted in ascending order is rotated at some pivot unknown to you beforehand.
(i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2).
Write a function to determine if a given target is in the array.
The array may contain duplicates.

100)Word Ladder
Given two words (beginWord and endWord), and a dictionary's word list, find the length of shortest transformation sequence from beginWord to endWord, such that:

Only one letter can be changed at a time.
Each transformed word must exist in the word list. Note that beginWord is not a transformed word.
For example,

Given:
beginWord = "hit"
endWord = "cog"
wordList = ["hot","dot","dog","lot","log","cog"]
As one shortest transformation is "hit" -> "hot" -> "dot" -> "dog" -> "cog",
return its length 5.

Note:
Return 0 if there is no such transformation sequence.
All words have the same length.
All words contain only lowercase alphabetic characters.
You may assume no duplicates in the word list.
You may assume beginWord and endWord are non-empty and are not the same.

101)Find Largest Element in Each Row
You need to find the largest value in each row of a binary tree.

Example:
Input:

          1
         / \
        3   2
       / \   \
      5   3   9

Output: [1, 3, 9]

102)Find Left Most Element
Given a binary tree, find the leftmost value in the last row of the tree.

Example 1:
Input:

    2
   / \
  1   3

Output:
1
Example 2:
Input:

        1
       / \
      2   3
     /   / \
    4   5   6